ID: 933264715_933264721

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 933264715 933264721
Species Human (GRCh38) Human (GRCh38)
Location 2:80169383-80169405 2:80169436-80169458
Sequence CCAATCAGAATCTGGCCTTCCCA TACGTGTTACAAAAGAAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 179} {0: 1, 1: 0, 2: 0, 3: 17, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!