ID: 933279971_933279984

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 933279971 933279984
Species Human (GRCh38) Human (GRCh38)
Location 2:80322623-80322645 2:80322667-80322689
Sequence CCCGGCCGCAGCCCAGCCGCCGC AAACGCGTGTGTGGGGAGATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 76, 4: 627} {0: 1, 1: 0, 2: 1, 3: 8, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!