ID: 933286627_933286635

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 933286627 933286635
Species Human (GRCh38) Human (GRCh38)
Location 2:80391239-80391261 2:80391283-80391305
Sequence CCCTCTTCACTCTGTTCACACCA CATTCTTCTCATCTGAAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 379} {0: 1, 1: 1, 2: 32, 3: 507, 4: 6892}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!