ID: 933419855_933419865

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 933419855 933419865
Species Human (GRCh38) Human (GRCh38)
Location 2:82031232-82031254 2:82031283-82031305
Sequence CCAGACTCAGGGTACCCACTGGG TTTATGCAAATTTCTGCAGCTGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 17, 3: 81, 4: 963} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!