ID: 933423092_933423101

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 933423092 933423101
Species Human (GRCh38) Human (GRCh38)
Location 2:82077091-82077113 2:82077124-82077146
Sequence CCAGAGACTGGTTTCATGGGAGA ATGGACTACGTGGTGGGGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 15, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!