ID: 933443754_933443762

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 933443754 933443762
Species Human (GRCh38) Human (GRCh38)
Location 2:82350174-82350196 2:82350209-82350231
Sequence CCATGCCCACTTCGGCTTTGGGA CATCCCTAGACGCTACTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 15, 4: 140} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!