ID: 933467214_933467217

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 933467214 933467217
Species Human (GRCh38) Human (GRCh38)
Location 2:82668221-82668243 2:82668243-82668265
Sequence CCAAGTTGATCCTTATTCCATCA AACAAATTATTTTAATATATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 133} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!