ID: 933486885_933486894

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 933486885 933486894
Species Human (GRCh38) Human (GRCh38)
Location 2:82935439-82935461 2:82935472-82935494
Sequence CCTGCCCCTCAATTTGCATTGAC ATTTACTTGCAATTGAAAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 11, 3: 65, 4: 500}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!