ID: 933488368_933488380

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 933488368 933488380
Species Human (GRCh38) Human (GRCh38)
Location 2:82950819-82950841 2:82950865-82950887
Sequence CCACCCTCCTTCTGCTCACCCTC CCAGTCCCAATGAGATGAGCCGG
Strand - +
Off-target summary {0: 2, 1: 151, 2: 439, 3: 924, 4: 2402} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!