ID: 933557918_933557920

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 933557918 933557920
Species Human (GRCh38) Human (GRCh38)
Location 2:83853403-83853425 2:83853442-83853464
Sequence CCACTAAAAATCATTCACTCAGC TAATAGTAATATGGTCTTAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 6, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!