ID: 933579220_933579225

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 933579220 933579225
Species Human (GRCh38) Human (GRCh38)
Location 2:84105763-84105785 2:84105797-84105819
Sequence CCACAAAGGGAAGCCCATCAGAC CTCTCGGCAGAAACTCTACAAGG
Strand - +
Off-target summary {0: 5864, 1: 2938, 2: 903, 3: 329, 4: 257} {0: 7, 1: 24, 2: 32, 3: 38, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!