ID: 933579222_933579225

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 933579222 933579225
Species Human (GRCh38) Human (GRCh38)
Location 2:84105776-84105798 2:84105797-84105819
Sequence CCCATCAGACTAACAGCGGATCT CTCTCGGCAGAAACTCTACAAGG
Strand - +
Off-target summary No data {0: 7, 1: 24, 2: 32, 3: 38, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!