ID: 933586447_933586451

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 933586447 933586451
Species Human (GRCh38) Human (GRCh38)
Location 2:84184840-84184862 2:84184877-84184899
Sequence CCATTCCTAGACCCACTGAGATC GATTTGTGAACCAACATGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 102} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!