|
Left Crispr |
Right Crispr |
| Crispr ID |
933610902 |
933610905 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:84434116-84434138
|
2:84434158-84434180
|
| Sequence |
CCATGCATGTATAGCCTGCAGAA |
CTTTTACTTATAAATCATCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 37, 2: 380, 3: 488, 4: 546} |
{0: 1, 1: 0, 2: 5, 3: 44, 4: 371} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|