ID: 933612722_933612726

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 933612722 933612726
Species Human (GRCh38) Human (GRCh38)
Location 2:84453994-84454016 2:84454008-84454030
Sequence CCCATCTAGAAGTGGAATAACAG GAATAACAGCTGCCCCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 119} {0: 1, 1: 0, 2: 1, 3: 13, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!