|
Left Crispr |
Right Crispr |
| Crispr ID |
933638648 |
933638653 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:84735092-84735114
|
2:84735133-84735155
|
| Sequence |
CCTTTATGTCTGTGTGTACCCAA |
AAGTGAGACCATACAGTATTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 2, 2: 16, 3: 60, 4: 307} |
{0: 1, 1: 146, 2: 1815, 3: 4156, 4: 11772} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|