ID: 933650830_933650836

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 933650830 933650836
Species Human (GRCh38) Human (GRCh38)
Location 2:84848943-84848965 2:84848988-84849010
Sequence CCTTCACTGTTTCTGAAGGAAAT TAGGATAACATCAATGACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 316} {0: 1, 1: 0, 2: 1, 3: 3, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!