ID: 933654964_933654978

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 933654964 933654978
Species Human (GRCh38) Human (GRCh38)
Location 2:84879971-84879993 2:84879997-84880019
Sequence CCCCACTCCCTCAACCCACCCCC CCCCCCCACCCCCGCGTCGCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 14, 3: 193, 4: 1549} {0: 1, 1: 0, 2: 4, 3: 49, 4: 447}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!