ID: 933700950_933700952

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 933700950 933700952
Species Human (GRCh38) Human (GRCh38)
Location 2:85255231-85255253 2:85255246-85255268
Sequence CCTCTGGTTCAGGACCAGGGTGC CAGGGTGCATGAGCATCACCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 7, 4: 134} {0: 1, 1: 0, 2: 10, 3: 86, 4: 580}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!