|
Left Crispr |
Right Crispr |
| Crispr ID |
933716332 |
933716334 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:85363779-85363801
|
2:85363825-85363847
|
| Sequence |
CCTGTTTTTAAAACCATCAGATC |
GAGAACAGCACAGCAGAGACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 296, 1: 1388, 2: 3049, 3: 2710, 4: 2200} |
{0: 1, 1: 1, 2: 19, 3: 203, 4: 664} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|