ID: 933724560_933724569

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 933724560 933724569
Species Human (GRCh38) Human (GRCh38)
Location 2:85419105-85419127 2:85419129-85419151
Sequence CCGGCAGGACTCGTGGTGAAGCC GGGGAAGGCCTGGGTCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 105} {0: 1, 1: 0, 2: 1, 3: 43, 4: 436}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!