ID: 933724827_933724842

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 933724827 933724842
Species Human (GRCh38) Human (GRCh38)
Location 2:85420816-85420838 2:85420865-85420887
Sequence CCCTCCTCACCACCAGGGGTCGC TCCCCACAGTGGCCCGGGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 176} {0: 1, 1: 0, 2: 1, 3: 21, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!