ID: 933726520_933726529

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 933726520 933726529
Species Human (GRCh38) Human (GRCh38)
Location 2:85430493-85430515 2:85430525-85430547
Sequence CCCTCTCCCCTCCATTCCTGCTG TCCCTTCCTCCAGGCCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 132, 4: 1251} {0: 1, 1: 0, 2: 7, 3: 56, 4: 481}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!