ID: 933727218_933727225

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 933727218 933727225
Species Human (GRCh38) Human (GRCh38)
Location 2:85433787-85433809 2:85433809-85433831
Sequence CCTGCCTGTGGTCCAGGCTGACC CCACACTGTGCCAGCAAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 346} {0: 1, 1: 0, 2: 4, 3: 13, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!