ID: 933729171_933729181

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 933729171 933729181
Species Human (GRCh38) Human (GRCh38)
Location 2:85444513-85444535 2:85444532-85444554
Sequence CCCCGATGCCCCCCACCAGCCCT CCCTTCTACTTAGCTCCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 441} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!