ID: 933751170_933751177

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 933751170 933751177
Species Human (GRCh38) Human (GRCh38)
Location 2:85602740-85602762 2:85602763-85602785
Sequence CCGCGCCGCCCGCCGGGACGTGG AGTCCGCGCAGCCCCGGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 364} {0: 1, 1: 0, 2: 2, 3: 12, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!