ID: 933789208_933789215

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 933789208 933789215
Species Human (GRCh38) Human (GRCh38)
Location 2:85870422-85870444 2:85870447-85870469
Sequence CCCTCCTCGTTCTCCTTTTTCAT CCTAAGAGTTAGGATCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 100, 4: 948} {0: 1, 1: 0, 2: 1, 3: 6, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!