ID: 933791850_933791863

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 933791850 933791863
Species Human (GRCh38) Human (GRCh38)
Location 2:85889163-85889185 2:85889180-85889202
Sequence CCCCTGCAGGGACGCACCCGGGG CCGGGGCGGGGGCCAGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129} {0: 1, 1: 2, 2: 15, 3: 181, 4: 1858}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!