ID: 933800512_933800517

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 933800512 933800517
Species Human (GRCh38) Human (GRCh38)
Location 2:85956720-85956742 2:85956743-85956765
Sequence CCTCTGTGATTCACCCATTTCCT ATTCACTGAGTGGTGCCATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 367} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!