ID: 933824439_933824444

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 933824439 933824444
Species Human (GRCh38) Human (GRCh38)
Location 2:86145806-86145828 2:86145821-86145843
Sequence CCACCCAGGCACATGCGACATAG CGACATAGCCAAAGGATACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66} {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!