ID: 933833787_933833796

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 933833787 933833796
Species Human (GRCh38) Human (GRCh38)
Location 2:86230316-86230338 2:86230347-86230369
Sequence CCTGAATAATTCACCAGGGGAGG GGAGGCCTGGATTCTGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 106} {0: 1, 1: 1, 2: 10, 3: 65, 4: 547}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!