ID: 933847542_933847551

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 933847542 933847551
Species Human (GRCh38) Human (GRCh38)
Location 2:86337703-86337725 2:86337721-86337743
Sequence CCAGCCCCCCGGGGCTCGGCGGG GCGGGCCCGCAGCGATTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 345} {0: 1, 1: 0, 2: 0, 3: 8, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!