ID: 933902205_933902209

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 933902205 933902209
Species Human (GRCh38) Human (GRCh38)
Location 2:86858166-86858188 2:86858198-86858220
Sequence CCGGCTTGCATCCCGAAACACAG CCTGTTCCACCTCTTCACCGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 119} {0: 2, 1: 0, 2: 1, 3: 15, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!