ID: 933927125_933927130

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 933927125 933927130
Species Human (GRCh38) Human (GRCh38)
Location 2:87104251-87104273 2:87104276-87104298
Sequence CCAGGGACCAGCTTTGTGGAAGA ATTTTTCCACAGATGGGGCACGG
Strand - +
Off-target summary No data {0: 3, 1: 8, 2: 62, 3: 190, 4: 574}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!