ID: 933947996_933948003

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 933947996 933948003
Species Human (GRCh38) Human (GRCh38)
Location 2:87304286-87304308 2:87304312-87304334
Sequence CCTACATAGTGATTTTCTTCCAA GTGTAGAATAGATAGGGGGTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 14, 4: 237} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!