ID: 933990402_933990404

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 933990402 933990404
Species Human (GRCh38) Human (GRCh38)
Location 2:87629801-87629823 2:87629818-87629840
Sequence CCTGCAGTGTGACTCAGCAGGCC CAGGCCAACAGATGCTATCAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 9, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!