ID: 934031809_934031822

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 934031809 934031822
Species Human (GRCh38) Human (GRCh38)
Location 2:88055421-88055443 2:88055456-88055478
Sequence CCTCCGCACTCCACTCGGAAGCC TCCGGGGGCGGCGGCCGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105} {0: 1, 1: 1, 2: 2, 3: 41, 4: 456}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!