ID: 934035078_934035080

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 934035078 934035080
Species Human (GRCh38) Human (GRCh38)
Location 2:88082473-88082495 2:88082498-88082520
Sequence CCTCAGCTGGCTCTGCACCTGTC TCCCCTTCCAGATGCCATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 383} {0: 1, 1: 0, 2: 1, 3: 16, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!