ID: 934068796_934068806

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 934068796 934068806
Species Human (GRCh38) Human (GRCh38)
Location 2:88364744-88364766 2:88364788-88364810
Sequence CCTGGTTTCAGCTGAGGGCCAGG GGTGCTTAGCGGGTGCCCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 283} {0: 1, 1: 2, 2: 1, 3: 5, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!