ID: 934078964_934078969

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 934078964 934078969
Species Human (GRCh38) Human (GRCh38)
Location 2:88451895-88451917 2:88451932-88451954
Sequence CCTGGGTCGTCCTCGTCGCGGGG AGTCGTTGAGCGACAGGTTGTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 1, 4: 33} {0: 3, 1: 3, 2: 12, 3: 7, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!