ID: 934085305_934085318

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 934085305 934085318
Species Human (GRCh38) Human (GRCh38)
Location 2:88504395-88504417 2:88504444-88504466
Sequence CCGGACCCACCAACACTTGGAGA CCTGGAGTTTGAGACCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 256} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!