ID: 934099369_934099373

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 934099369 934099373
Species Human (GRCh38) Human (GRCh38)
Location 2:88637946-88637968 2:88637978-88638000
Sequence CCCTACCATTTTCTCTCTTGAGA AATTATAAGCAAAAAGTGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 61, 4: 565}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!