ID: 934215451_934215461

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 934215451 934215461
Species Human (GRCh38) Human (GRCh38)
Location 2:90027582-90027604 2:90027612-90027634
Sequence CCAAACCCTACCTGATGTGGGCT GGCAGAGGGGAGGCTGCCAATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 119} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!