ID: 934273944_934273953

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 934273944 934273953
Species Human (GRCh38) Human (GRCh38)
Location 2:91563638-91563660 2:91563684-91563706
Sequence CCAGAGCAGGGCTGGACCAACGT GACACTTCCAAGTCCATCTCTGG
Strand - +
Off-target summary No data {0: 2, 1: 3, 2: 25, 3: 52, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!