ID: 934419803_934419804

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 934419803 934419804
Species Human (GRCh38) Human (GRCh38)
Location 2:93528903-93528925 2:93528943-93528965
Sequence CCTTTCTTTTGATAGAGCAGTTT AATATCTGCAAGAGTATATTTGG
Strand - +
Off-target summary No data {0: 9, 1: 1517, 2: 3262, 3: 5790, 4: 43965}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!