ID: 934461669_934461673

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 934461669 934461673
Species Human (GRCh38) Human (GRCh38)
Location 2:94216351-94216373 2:94216364-94216386
Sequence CCAGGGCCAAGGCAGGGCCAGAG AGGGCCAGAGCTGGACTTGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!