ID: 934465856_934465862

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 934465856 934465862
Species Human (GRCh38) Human (GRCh38)
Location 2:94262410-94262432 2:94262441-94262463
Sequence CCCTTCCTGTGTCAACTGCTCAA CCCCATGAGGTCATCAGTGCAGG
Strand - +
Off-target summary {0: 12, 1: 4, 2: 3, 3: 29, 4: 220} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!