ID: 934520872_934520877

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 934520872 934520877
Species Human (GRCh38) Human (GRCh38)
Location 2:95019375-95019397 2:95019397-95019419
Sequence CCTTTCTCCCTGTCCTTCAAGAA AGCACTCATGGCCCTGCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 444} {0: 1, 1: 0, 2: 1, 3: 28, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!