ID: 934522741_934522748

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 934522741 934522748
Species Human (GRCh38) Human (GRCh38)
Location 2:95030241-95030263 2:95030269-95030291
Sequence CCTTTCCAAATACCTCCAGAGCC GGCTGTGCCCCTATTGCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 223} {0: 1, 1: 0, 2: 1, 3: 8, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!