ID: 934522947_934522952

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 934522947 934522952
Species Human (GRCh38) Human (GRCh38)
Location 2:95031321-95031343 2:95031336-95031358
Sequence CCCCCAACAGGAATGAAGGGACA AAGGGACAGCTCAGGACCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 193} {0: 1, 1: 0, 2: 2, 3: 15, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!